Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D127F12
Clone ID D127F12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD127F12
Sequence
TCTGCGGCAGAGATGAAGCCCTTTTTGTCTAGGTGTGTGGTGGGTTTGAGTGGTGAGGCATATGGTACGACTCTCTTAAC
TGGTGGCCACTTGTCCCATCCTCCCTAGCACTGTCTGACCCCAGTATTGTGTTCTGTCAGATTCCCTCACCAGGACCACC
CAGGTTCTTCTTTTTTAAAGATTGCTTTAAGTGAATTGGTGTTTTGCCTACATACATGTCTGCACAC
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20326703..20326929 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]


SPLK-Sequence tag 3SD127F12
Sequence
AAGTCTACCAAGGTCTGTGCCTAGCAAGACTGAGTTTGGGATGTTTGTGAGCCACCATCTCAGGTAACCCAACCCAGGCC
CTCTGCAAGAACAATGGGTGCTCTTAACTTCTGAGACATCTCCCCAGCCCTAGCCCTATTAGAAGTGGTAAAACTCCACA
CTCGATGTAGCAATGCTGGAATAGACTGAAGACGATCGCTTGACTGGCCTGGAACTCACTATGCAGCCCAGGCTTTCTTC
AGACACACAGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es