Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D127F07
Clone ID D127F07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD127F07
Sequence
GGTCCTTGTGGGCCCGGGAGGGTGGGCAGAAATCGTGGTGGGGCCGGTAAAAAGTGTAGCAGAAACTTGGGCTGATAGTT
TTTTAAGTTGTCATTTACTATGTGATAACGCCACTCTAGAATCCCTTGCTAAGAAAAACAAATCT
Sequence Type genomic DNA
Unitrap ID UNI30072

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 132073165..132073309 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027341 (5730494N06Rik) NM_027478 RIKEN cDNA 5730494N06 gene Gene [Source:MGI Symbol;Acc:MGI:1917862]


SPLK-Sequence tag 3SD127F07
Sequence
GGACAGCACATAACTTTATAACTTGCAAAACAAATCAGGCATGTTTTAATGCTTCGAAAATCCTGCTTATTGGTAGCTTC
AACTTTTAGGTATGAGGAAATAAACATGCTANNCTCACGCTCACATCTCTAAACCTAGNANNCTAAGCCTTAGAAACGCT
AATGGATTCCCGTTGCTCCTTTTTAGGACTTCTGAACTAGGATGCAACTCACCAAAACGCAGAAACACTTGACACCAGTT
TTTTGCATGCTAGATACTTAAGGTCGACTGTGACACCAGTGCCTGGCAGCTCATTAAGATCGAAAAAATATCACATGCCA
TTGTGGAGATTATGTGCTAAACATCACACCAGACAAGGCCACTCAGCTTTCTTCTTAAAGAGGGGCTTTTTGCGCTTAGA
ATTCAAATGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027341


For any suggestions or comments, please send an email to unitrap@crg.es