Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D127B12
Clone ID D127B12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD127B12
Sequence
AATTGGAAATAAGTAGATTCCTCAAGTTGGCATCTCAAGGCTCGGAGGTATCAGTCGCTGATATGATGGCCAAGGGCAGG
TGTGTGCATGTTCTTGTCGTCCATGAGGGTACAGATGTGCACATGTGTAAATGTTCCTTTGCTTAGCAATATTATACTCA
GCTGTGCCAACAAATGGTTCCACGGTAGAAGTGAATAGAATTGTTGTTTCTCATTAGTTTCCCTCTTGTGTTACAGTATT
AGGTGTTAAAAAAAAAATCCTGTATCCTAAATACAAATTGAAAATCGCTGTTTTAAAATATGCTAGAAATTAGGGTCGGG
GTTGGCATTTGCGGACATGTATGCCTGTGGCTTTAAGTATTCCACTGTATTGTAAACTTACTATGTAACAATGCTAATAC
AGAAGTATAGTAAGGATGTAAACACCGCACCTTATCTTATATGGTTATAAAGCCTCTTTCATGACAAAGCACACACTGAA
CCACAGAGTTTCTCACACGAGGGACCGTTCATGTCCTGTAATGTCAAAATCCTCCTTATAATGTGCTTGGAAATTTTGAG
TTCTGCTCTCTTCATATGCGTCTTTGAATGAAGTGTGATTGGGCGGTCTGGAGTTCCTGCCACAGGAGATGGGCTGGCTG
CTGTTTAGCACAAGCTTTTCAGACTACCGACCTATCACGAGCAGCAGGACAGCCTCTTCTCTAGCACTGTCTCCCTACTC
TGTTTGCTTTCTTTCCTGCATGCTGAAAGATGCTCTTCTCTACTCAGTAG
Sequence Type genomic DNA
Unitrap ID UNI10238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12732757..12733537 667
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]


SPLK-Sequence tag 3SD127B12
Sequence
TTGAGCTCCAGNNAGGACAAAATTTCAAGAGCTGTGTTCAGAATTCTCATCCAGAGAGGTAATGACTTCTGGGACTTGGC
AGTTACTTTGTGCGGAGGGGCCTAAGCCAGAGTCATCGCATGCATCCCAGGGGACACCCCCTGCATCACCTTTCTTCTGG
TTATGACAGTCAAACCTCTCGGACATNNACTAAATGTTCCATGGAAATCACACCCAGGTGAGTCCTGCTGATGCCCCACT
TTCACAGGATTGTGNNCTCGTAATTGGACTGTGTCCTACGTCTCAGAACTGAGGAAGTTTATTTCCTACCCTTCATCCCA
CTCTCGATGCTCAGGAGCACGTGAGTTTGGTAAGCATCTGGGGATGCTTATAGACTGAGGTGAACTTAAGTCCCCTTCTC
AGCTTGCACAACTCTGCAGCCTCTTCACAGTCTGAAGTTCCTCTTTCCGTTGGACCAGAGAGCTTCATGCAATGCAGCAA
TCAGACTGTGAGTGTGAGAGTAGTCAGTTCTCCAGGGACAGGCTAGAAAAGTCATCAGTGTCTGCCTTGTCAAAGTACGG
CATTCGTGTGTTAATAGTCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es