Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D056B01
Clone ID D056B01
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D056B01
Sequence
ATGGAGCTGCGTGTGGGAAATAAGTATCGCCTGGGCCGAAAGATCGGCAGTGGCTCCTTTGGAGACATCTACCTGG
Sequence Type mRNA
Unitrap ID UNI10456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79269202..79269277 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022433 (Csnk1e) NM_013767 casein kinase 1, epsilon Gene [Source:MGI (curated);Acc:Csnk1e-001]


SPLK-Sequence tag 5SD056B01
Sequence
GATCTCATTGCTCTGGGAGCTCCCTGTCCCTGGATGTGTCCCTGATGTCATTTTAGGCAGATTGCTGGCATCTCAGCACC
CCCCCCCATCCCCCTCAAGTGTCGCCTTCCTAGCCTGGCCAGCCATGCGCCATTTTGAGTGTTGTCAGCCTGGAGGGGAG
AGTTTGCTTGGTAACTGCACGGATGGAGTTTTGAGTCTTGGAGTTGCTTGTGTGGTTGCAAGCCTCCTAG
Sequence Type genomic DNA
Unitrap ID UNI14402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79268516..79268749 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022433 (Csnk1e) NM_013767 casein kinase 1, epsilon Gene [Source:MGI (curated);Acc:Csnk1e-001]

 
Come back to gene ENSMUSG00000022433


For any suggestions or comments, please send an email to unitrap@crg.es