Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D127A05
Clone ID D127A05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD127A05
Sequence
TCTGGTTTTAGTTTTTTCCAGCAGTATGATACTGTTGATAATCAAGTGCAGTCTTTGGTTATTGGCTTTTCTAGTCTTCC
CAAATTCAAGTTGTTTTTCAAGAAAATCACATTTAACTTTACCCTGTGAAAGAAAATTTTGTCAACAGTCTGTTGCATGA
ATCATCAAAATTAGACTTCTCCAATCCTGAAAAGTTGATGATCTCTGAAAATAAGTCTTAAAAGGAGTCTAAGCTGATTC
AATC
Sequence Type genomic DNA
Unitrap ID UNI29607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21777686..21777929 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]

 
Come back to gene ENSMUSG00000028248


For any suggestions or comments, please send an email to unitrap@crg.es