Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D126C09
Clone ID D126C09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD126C09
Sequence
ACGTGTTCTTATGCATATGTGCAGGGTGGGATGGAGCCCAGTGATGGTGGTTTGGAGTGCACACCCTAACAGACATTTCA
ACTAGGATGCAAAGTGGGTTGGGGTCTGTTGAGTGTAGGGTGCTGGTGCCGCTTAGGACCGTGGAGGATGAG
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119517927..119518078 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]


SPLK-Sequence tag 3SD126C09
Sequence
CCCTATCTTACCAACTTATTTTTTCAAGCCCTTGCTCAAATTCTCAGCCCTTCTGTAGTGGTGGAATTGCAGGTACAGTG
CTTGGTGCAGG
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119518106..119518196 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es