Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D125A06
Clone ID D125A06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD125A06
Sequence
TAAAGAAAGCTCTCCCTGCCTCTGCTTCTGCTTCACAGTGCCTGAATTGTCCTCCTGCCCAGCCCTAGATGACTGGA
Sequence Type genomic DNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91650130..91650206 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es