Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D124F10
Clone ID D124F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD124F10
Sequence
AAAACCCCTGGCAGAATTCTTAAGAGCATCCACAACGCACACAATTTTTTTTCCAAAATGGCGTGTCTATAGATCATCTT
ATTTCTCTCCAGTAAGATGACTTTGATTTAAGCAATTATGTACCATTTTCCTCAAGTGTCCCCAAATCCTATGAAAACTA
TCAGTTTCATTCTCCCATTGTTTTTTTCAAGTGTCCCACAAACTAGCTGGAGAAAGAAGCTTCTGCTGTC
Sequence Type genomic DNA
Unitrap ID UNI30077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101391576..101391805 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046449 (C77370) NP_001070822 Uncharacterized protein KIAA2022 [Source:UniProtKB/Swiss-Prot;Acc:Q5DTT1]

 
Come back to gene ENSMUSG00000046449


For any suggestions or comments, please send an email to unitrap@crg.es