Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D124F03
Clone ID D124F03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD124F03
Sequence
GATCTCAGGCCACAGTTCTCTTCCCCTTGGAAGACTAGTCAGAGGACTGGGCCGGGTAGAGACAGCCACATGGTCTGTGC
GTACGTAAATTAAAGCAGCCATTGGTGATGAAAAGCGGGGAGTCTTTGTAGTTTGGGAGTGAACAGGAAGTTGTGCCTTG
TCAGGAAGAAAAGAATTCTATGGACC
Sequence Type genomic DNA
Unitrap ID UNI16579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20128750..20128935 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es