Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D124E06
Clone ID D124E06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD124E06
Sequence
AAATGAATATATACATTTTTAAAGCAGCGATTCTGTGGCTAAGCTTTGGCATAGTGTGGGTGCGAGACTCGTACGGCTTT
CAGGACACAGTTTGTGCTTCAGCGTTGAGAATTTCATATAAAGCTCCAGGTCGCACTGTTTTTCTTAACATGTGTCTGAA
CATTACTTAGAATGACTTATTTCTTAAAAGGACGTTGCTGTGGAGACCTGGTGGCCTCGTGGACATGGGAACCAGACTGG
GTATAACATGACAATTCTCTTTGCTCTGGATG
Sequence Type genomic DNA
Unitrap ID UNI11183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135187291..135187562 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es