Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D124E03
Clone ID D124E03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD124E03
Sequence
GATCTGAAGGTAAGGTCTGGGACGGAGGAAGGAGAAGGGCAGAATTGGAAAGGGCAGTTCCTGAGGAGAGCTGACTGAGG
CTAACCAGTGCCGGTTTCGTCTTTCTTGGCAAGCTGAACTACGGCTCCCAGCAGCCTCTGCGGCATCCTGCTTCTTGTGG
GAATCGGCTTCGTGTCCCTAGGCCTGATGGGAATGGTAGCTTCCCGGGTCTCCGCAACTCAGACCTAGGCCTGGGGTCTT
AGTGTGATGCAGAGCTGGGAATTTGGGGTACTCGTGTGCAGGGATGGAGTAGTATAGTCACTGGTGTAAATTTTCGCTAG
TGTTTAGTTCCTCACGGTGCTATTTTCACCGCATCCTTGTAGCT
Sequence Type genomic DNA
Unitrap ID UNI14502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137438090..137438453 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019054 (Fis1) NM_025562 Friend virus integration site 1 Gene [Source:MGI (curated);Acc:Fis1-002]

 
Come back to gene ENSMUSG00000019054


For any suggestions or comments, please send an email to unitrap@crg.es