Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D124C08
Clone ID D124C08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD124C08
Sequence
GGCACTGACAGTTGAGAGGTTCCCCACACAGATGTTCAAAGCGGCCCCTTTGAGGAGGCCAGGACCGGTCTTGCTCCTTT
CCAGTGAGTTTGGAGGGATTTAGGTTGGAGCTCTAGAGTTTCCACTATCCAGACTGCGGGAATGTTTACAAGGTGGATGG
ATTTAGGTAGGGCTCACCCCAAACCGACCCTTTGTAGCTGAAGCACCTGGGTGGGGCTTAGGGCGGTGAAGCTCAGGGTC
CGCCTAGTGGCAGAGTCCCATTAGCTTTCTGTTATAAATTCTTACACTTCCAGTAAGCAGCGATCATCCCCAGTGCTGTA
AGGAAGGAGACTGGCAGCCAGGAGGCCCGTGTAGGCTTGCAGATTCTTAGAAGGACGCGCCCAATTTCCCAAGTTTAGAA
CTGATCACGTGATTTCAGGCTTCTCAAGTGGTTCCACTGAGTTTTTCTGGGGTGATCCAGTGTTTGCTTCCCCACCCCCA
AAACGGTCCTAAACTCCAGGTTACTGGGTGTGTATCCGCAGGAAAGCTTGTTTGCTCAGCCTAAATAAATAGCCCCGGGG
AGAATTCCCATCCCTGTGAAGGCATTGCTGCTGCCAGGGGTGGTGATCCACGCCTTTAGTCCCAGCCTTGGAGATGATGC
AGCGAGACCCTCCCTCTCAACTACACACCTAGGTGGCTTCAGTACAGGCTATTGGCCTCTGCACAGCTGTCT
Sequence Type genomic DNA
Unitrap ID UNI13223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124115154..124115865 712
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031812 (Map1lc3b) NM_026160 microtubule-associated protein 1 light chain 3 beta Gene [Source:MGI Symbol;Acc:MGI:1914693]

 
Come back to gene ENSMUSG00000031812


For any suggestions or comments, please send an email to unitrap@crg.es