Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D124B09
Clone ID D124B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD124B09
Sequence
CTTAGTTATGTCTTCTATAGTGATGTTCCCACCATAGAGTTCAAACAGTGCATTTGTATAAAGAGAAAGAAAATCGCAAA
TGTCCTTGCAGAACTCATCCCAGTTGTCCCTACCTCTTGATATCACCACTGCCCATACCTCAGTCTGCATGTTTTTGTTC
ATATCCTTAAAAGACAAATATGGACATGTGCACATACACAACATCGGGTTTGGATCC
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73020297..73020513 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es