Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D123C11
Clone ID D123C11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD123C11
Sequence
CTGAGATAGAGTCCCTTAGGTCTATNNAANNCCCAGGCATCTCTGAGGTCATAGTAGGTGTTTGTTATAACATGTGCCCC
GTGCCCCGGTAGCAGGGCCTACAATCAGAGCAGGTTTCTTTTGTCCTGAAGCAGTTTATCCAATCACAGCTGAGGCTGGG
AAACTAAGCCGAGCAGAACCCCAGGCCAGGAAACATTCGAAAGGCAGTGTCAGCTCAGCCTCTGTGGATACCCGACAGGC
AAGAAGGCTTTGTGCACGTGAGGAAGGAAGAAACATTTTGAGAGTACACACGGTTCTACCAGAATTGTGTGTGTTCTCCT
TCTCTAACTTGTTGCTTTCGCTGACCTGAGTTGTGTTCAAGCTGTAATTTATAACACCTCTGTCTGTTGAGGTCATGCAT
TGTATGTTCTTAAGCTTTAAAAATAAACCCATTTGGGGGAGGGAAATTGAACCCGTGTGATAATGTTAGGCATGCAAACG
CATGAGCTGAGAAAGTAAAAATCATGGTTTCCATGGTAACTCCTAACTTCTCTGAGTTGTGTGGTATACTTAACTCACGC
AGTACATTGGCCAGGATTAC
Sequence Type genomic DNA
Unitrap ID UNI17159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20547050..20547629 552
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es