Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D122B10
Clone ID D122B10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD122B10
Sequence
AAAAGAAGGAAAACAAAAAATAGGACATTTTTTCTAGTTTTAGTAGGAGTCCCTGTCTTGTTCATATTAATTAATTGGTA
AAGCGTTTTATATGTTAATGTTGCGTTCTATCATAAAGAGTAGTATGTCTTCTCCTGTTTTGTGTAGTGGTGGTGGTCCC
TGTGTGTTTCTTCCATGGTAAAGTTGTCAGATTTGTAAACTGGACTTTTATTAGGCGAAAGTTCAAGGTTGCGCTCCTAC
AGGTAGGGGAACTTGGCCTAAGATGTGCCTTAGCTTGGAATGAGCCAAATCTTAATGATGAGAATTTATAAAGCTTAATG
AAATACTGTAATTCTATTACCTTATATTGATTTTCCAGGGGAAACTGTTTGATTCTACAATTGCTGATGAAGGAACATGG
ACTTTGGGTAAGAGAAATCTGTTATGATTCATACACTTAAAAATTGGATCATGG
Sequence Type genomic DNA
Unitrap ID UNI13175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40549162..40549615 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]


SPLK-Sequence tag 3SD122B10
Sequence
TGGTATCATTTCTCCTTTATATTGTCTTGTCTTTGTAGCTGTGAAAGATGGAGAAAAACGTGTTGAGAGCAATTGTCTAT
CAAAACTACCTAATA
Sequence Type genomic DNA
Unitrap ID UNI13175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40549613..40549707 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]

 
Come back to gene ENSMUSG00000020328


For any suggestions or comments, please send an email to unitrap@crg.es