Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D122A05
Clone ID D122A05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD122A05
Sequence
GTGAATAGCTTGGTGTGAATCTATAAGACTGTGCAAGTAGCCAGGTCAGTGCTCCTAAACCAAGACTATTACTTTTAATA
TTTCATGATCCTCTTTCAACAGAGCCAAGTCAGAACAACTCAGCAACCCTTGAATTTGACTCTCCAACTTTAGGAACCTC
GAAAAGTGAGACGATTTCTGGATANNAAACCTTCCTGTTNNNAGACATTGGCTTCATTTTATACTGTTTTGGCATGGACT
GTATTTATTTC
Sequence Type genomic DNA
Unitrap ID UNI16484

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36721233..36721483 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019777 (Hdac2) NM_008229 histone deacetylase 2 Gene [Source:MGI (curated);Acc:Hdac2-001]

 
Come back to gene ENSMUSG00000019777


For any suggestions or comments, please send an email to unitrap@crg.es