Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D121H09
Clone ID D121H09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD121H09
Sequence
ACCCCACTCTGTGTAGGGGAGAAACAGCCAAGGGAAGGGCTGGTGACCTGGCTATGTGCAGAGAGGCTGCCTCGACCTGA
GTCACCAAGTTCTTATCAGGCAGCCAAGTGGATGCAGCAGAATTGGAGCTGTCAGGGTTTCTCCAGCGGCCAGGATACTG
AATTTCCTTTCTGAG
Sequence Type genomic DNA
Unitrap ID UNI10480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57269829..57270003 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es