Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D119E05
Clone ID D119E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD119E05
Sequence
TGTAGATCATTTTAAAAGCAAGTAAACCTGTGGAGTGTGTGCTCATTGGTGACAATCAGATGTTCAGCGAGCATGTGCTC
TGTCTTAAAGCAGCTCTGGTGGACCCCTCCCTGCCTGCTTTGTATGCAGGAATGCTCTTTCAAGGACTACTTG
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116753719..116753871 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]


SPLK-Sequence tag 3SD119E05
Sequence
CTTGTTGCCTTCCCCCTTTTTGCTGGCCTGCCCAGGCAGAGCCCTTGCTTGAGGTCTTCCTTGACTTCCTATTGGAGTCC
CTTTGCAGACTGCACTCCCTGTTGTCAGGCAGACACAGGATCAGCCCAGCCCTCCTTACCTTTACAAACTCTAATGAGTA
TTCCACAAAACCCTGCTTGTAGGGACGGCTGTGCAGCCAGCT
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116753521..116753722 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es