Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D119A02
Clone ID D119A02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD119A02
Sequence
GATCTGAGGTAGGGTCCCAACACTCAAGTCAGGTGGCTTGTGGTCATCTGTGGTCTAGTTCTGATGCTACCTCTGGCCTC
TAGCAGACACCTACCCACTCCCTTAGACATAAT
Sequence Type genomic DNA
Unitrap ID UNI13623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107912878..107912990 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032594 (Ihpk1) NM_013785 inositol hexaphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1351633]


SPLK-Sequence tag 3SD119A02
Sequence
CGCATGGTNNNGGCGATAGTGGAGCNTGCCAACTACGGGGGGGACTTTCACTTAGAAAAATACCAAAGAGGGGAAAACCC
CAAAATGTCTATCAGCATCATCTGATGACTAGATAAGTAAAATATGTGTTCATGTAGGGTAGTCACGAGGGTCAGGCGGC
CGCACATGGTGACACACACACTTTTATTGCCAGAACTTGGGAGGCAGAAACAGGTGGGTCTCTGTGAGAGGTTAGCATGG
TCTACATACTGAGTTCTAGGACAGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032594


For any suggestions or comments, please send an email to unitrap@crg.es