Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D118G09
Clone ID D118G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD118G09
Sequence
GATCTCATCGATGAGGCCTATGGATTTGACTTCTATATTCTCAAGGCAAGCAGGGGTTAGTGCACTCCAAGGTCTTGTCA
GACTCGTGGGAAGTGCCGAGTGCACTGCATGGGCATGGGCAGGGAGTGTGGGGCACCCCAGGGTAGCCATTACAAGTAGG
ACTGAGTCCCTGTTGGTGCAGCCCCTGAAGCTTTCTGTCTTGCTGAGGCCACTCCCTGTGAGTCGCTGGACTTGTCCAAT
GGTTGTAGCCA
Sequence Type genomic DNA
Unitrap ID UNI19278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26261609..26261858 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024181 (Mrpl28) NM_024227 mitochondrial ribosomal protein L28 Gene [Source:MGI (curated);Acc:Mrpl28-001]

 
Come back to gene ENSMUSG00000024181


For any suggestions or comments, please send an email to unitrap@crg.es