Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D118F11
Clone ID D118F11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD118F11
Sequence
GATCCCAAATTGTTCTCTGGTGTGCTGTCTCATCCCTAGGTTGGTGCCGGTATCGGGCACTTGTTT
Sequence Type genomic DNA
Unitrap ID UNI30096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86591748..86591813 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031706 (Rfx1) NM_009055 regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]


SPLK-Sequence tag 3SD118F11
Sequence
GTTTCTGGTGATTGGGGGTTTCTCCGCTAGCTATTAAGGTGGTCACCTGTGGAAACAGCAAGCCAGTGGAGCTGTCTTAG
ATTCCTCAAGCCACATCTCTTGGCCAGTCAGTCAGTCAGGCCAGTATCAAGAGGGTCACATGTCATAAGGTGGTACAGGT
CGCACTCGCCAGGAGCCGGTATAGCATCAGAGGCAAGGAGAGACATTTGTTAGTGCAGGACCTTC
Sequence Type genomic DNA
Unitrap ID UNI30096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86591810..86592033 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031706 (Rfx1) NM_009055 regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]

 
Come back to gene ENSMUSG00000031706


For any suggestions or comments, please send an email to unitrap@crg.es