Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D117H04
Clone ID D117H04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD117H04
Sequence
GGAGAAAATGTTAGTGGGGTGAAATGAGTTCTCCACTAACTTTTAAACAAAATGAGTTTCCCTTT
Sequence Type genomic DNA
Unitrap ID UNI27228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 120324819..120324883 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031843 (Mphosph6) NM_026758 M phase phosphoprotein 6 Gene [Source:MGI Symbol;Acc:MGI:1915783]

 
Come back to gene ENSMUSG00000031843


For any suggestions or comments, please send an email to unitrap@crg.es