Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D117E12
Clone ID D117E12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD117E12
Sequence
GATCCAGTTCCAAGAGGTGTGTCTCATAGGAGACAGCTAGAAGCAAGGGCCTGACTAGACTGGAGCCAAGTGAGAAATCT
GCCCTCTTGAGGCCTAGCACAGAGCCGGCTGAAGAGTTCCAAGACCAAGTGAAACCCCTCCAGGAGTAGGACCTAGGATT
CCAGACTTTCTGTCAGACACCCTTGGATAAGCCTGTACCCCTGGGCTAGCCCTTATCACTGGGGAGTTCTGAGGAAATGC
CACCAGGGGAGCATGGTTAGAGGTAGCTGTGTTGGCTTCAGGGGGAGGGTAAGGATTGAGGCTGCTTTGTGGGGTTGCCC
TGCTATATCTACCCCATGTCCCCAGCCTCGGGGAAGTGAAGGAGCCAG
Sequence Type genomic DNA
Unitrap ID UNI30101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125971248..125971615 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001482 (Def8) NM_054046 differentially expressed in FDCP 8 Gene [Source:MGI (curated);Acc:Def8-003]


SPLK-Sequence tag 3SD117E12
Sequence
GGTGTTGTTGGAGAAAGGGGATGAGCCATGACGAGCCTGGGACACTCATCTCAGCCGTGCTGGGCCCTGCAGGTGGGATG
CTATGGAATATGATGAGAAGCTGGTTCGGTTCCGGCAGGCCCACCTCAACCCCTTCAACAAGCAGCTTGGTCCGAGGCAT
CATGAACAGGAACCCAGTGAGAAGGTCAC
Sequence Type genomic DNA
Unitrap ID UNI30101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125971616..125971804 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001482 (Def8) NM_054046 differentially expressed in FDCP 8 Gene [Source:MGI (curated);Acc:Def8-003]

 
Come back to gene ENSMUSG00000001482


For any suggestions or comments, please send an email to unitrap@crg.es