Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D117A11
Clone ID D117A11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD117A11
Sequence
TTTTGTGTCTTAAAATATCATTTAAGTCTTGAGGAGGTAGTGTGGAGTGAAGAGTTCAGCAGATGTAAATTCTAGGTCCC
CCTTGGCCAGTTCCTGCTTCTGATGATGTGGGCTGTCTGTTGGCATCCCGATCAACCAAGTGGAAGAAAATATTACCATC
CCTGAAATACGTTGTCTTGGAGGAGCGGCTGCTTCTATTGTTCAGTGACTGTCTTGTGAGTGTCAGCTCTTAGTCAGAGG
GTCTTGTTGGCTGTTTCCTTTCTTGAGTTGTCTGTCTGCTCTCTTAAGTAACCACTTTGTATCCCAAAGCTTATACTGGT
GAAAGCAGTCCACTAGTGGATTGAAGGAATCTTTGATCTTAAATACTTACAATCAGTAAAATTCCTAGGCAGCAT
Sequence Type genomic DNA
Unitrap ID UNI1457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121132480..121132874 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]


SPLK-Sequence tag 3SD117A11
Sequence
TTGAAAATAACATTTATCTGGAAAGATGCCAATGCATTGCAGAAACATATAAGCTTCTTTAAAAGGGCAGGGGGGGTGGC
GGCAAGAAAATATGAAAACCTGGATTAGAAAAAAATAGACTTGTTGCGTTGCGAACACATTCGCTGTTTCTGC
Sequence Type genomic DNA
Unitrap ID UNI1457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121132877..121133029 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]

 
Come back to gene ENSMUSG00000053931


For any suggestions or comments, please send an email to unitrap@crg.es