Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D117A10
Clone ID D117A10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD117A10
Sequence
GGTCCCGGGGTGGGCTACAGGGTACCAAGGGTACTGGTTCTTTGGGCTTGGGGGTTTTTAACCATTGGGGAAAACCCCCG
GGTTGGATATTTTTTCCCTCCGTTTTTTTTTTAAGGGAGAACTGTGTTACTTTGGGTTGTTTCAAAATTCCATTTGGGTT
TTCTTTTGACCGGTGGGGCCTTTTTTCCGCCCCCTATTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD117A10
Sequence
AACTGTGCAGTTTGTTGTCCTTGCTATTATTACTATCTGCTTATTTAGGTGTTTTAAAGATC
Sequence Type genomic DNA
Unitrap ID UNI6526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86258698..86258759 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es