Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D116A03
Clone ID D116A03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD116A03
Sequence
GAACTCACAGCTAGGAAGTGTGCAGAGGCTGCTTCAAGGGAAGGAATATGTGAAGTCACAGATTACTTAACTTGTTTGAG
AAACTGGGTGAAGTACAGTTGGCTTTCTATATTTGAGTTTTTTTGTATTGATGAATTGAATCGACCAAGGGCTTACAAAA
AATTGCATCT
Sequence Type genomic DNA
Unitrap ID UNI8501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 73907084..73907253 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028397 (Jmjd2c) NM_144787 jumonji domain containing 2C Gene [Source:MGI (curated);Acc:Jmjd2c-006]

 
Come back to gene ENSMUSG00000028397


For any suggestions or comments, please send an email to unitrap@crg.es