Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D114B02
Clone ID D114B02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD114B02
Sequence
GCTTCCCTGGGATTAGTGCTTAGCACTGAGAGGAAACACCTTGGGAAATTATGTGTGCGTCCCGTGCCCTCGGAGAGNNN
CCCCTGCTCACGGCCAGGTTGTTGGGATGGTGTGGGTGTAGACAAGTCAGGTGACTCAGCAGGAGAGAG
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121261445..121261591 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


SPLK-Sequence tag 3SD114B02
Sequence
AGTTACACCATTTAGGTTTTACTAAGTGTTAGTTCTTTGAGATTTTCATGCAGCCTGTTGTGATCACAGTGACCCTTCCT
AGCCCACCCA
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121261709..121261798 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es