Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D112D12
Clone ID D112D12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD112D12
Sequence
GATCCAGGAGGCCAGCAGGAACCGGTGGCTTGGGTCCTTCTTTCTGGAAGCCTAAAGTGCCTTTTATGTCAGTATTGCTT
ATTTCAGGGCCTGAGGTTGTAGCTTGGTGGTGGAACATTTGTCTATGCAAGGTCCTGGATTTTTGCAAGAACCCTCAAGC
AAAACGAAACAAAACTCCTGCCTAGTTTGATCAGTTTATGCAAAAATCTAGGAGGGTGGATTTTCATTTTCACCATGCTT
TAAAGCTTCAAAGGTTCTTTTATTATGAAACCATGGAGGCTGATCCTGCTCAAAGTCTAAAAGGACGTTTCCATTTCTTC
CAAGAACCTAGAACAGGGTTCTGCCGGCGAAGGCCTGCTGGTACATGGTCGTATGACTCCTACTTCAGGACACAGATAAA
CACCTGAGTCAAGTAGGCAG
Sequence Type genomic DNA
Unitrap ID UNI12870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35167761..35168180 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043681 (2200001I15Rik) NM_183278 RIKEN cDNA 2200001I15 gene Gene [Source:MGI Symbol;Acc:MGI:1916384]


SPLK-Sequence tag 3SD112D12
Sequence
GGCAGTCTCTTTGGACATGGCTGCAGCAGACACATCAGCACTTACTTCATTCTTAGCCCAGCAGCTGG
Sequence Type genomic DNA
Unitrap ID UNI12870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35167698..35167765 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043681 (2200001I15Rik) NM_183278 RIKEN cDNA 2200001I15 gene Gene [Source:MGI Symbol;Acc:MGI:1916384]

 
Come back to gene ENSMUSG00000043681


For any suggestions or comments, please send an email to unitrap@crg.es