Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D112A02
Clone ID D112A02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD112A02
Sequence
CCTGGCCTCTCCTGTGGCATTCTCTGTCCTTCTGTCCTTATCTATCTTGGGAGGGTTGGCGCTGGAGGTGAAGACCCTAA
GTATGGGGCGAAGTATGTGGGAAGCCTTGGTTTCCCAGATGAGG
Sequence Type genomic DNA
Unitrap ID UNI15218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27198200..27198323 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es