Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D111G08
Clone ID D111G08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD111G08
Sequence
GATCCTGAAAGATGCCCAGATGACTTGTTCAGCGTTGTCTTTTTCCCGCCTCTTTCCTTCTTTGCCCCAAATCCTAAGCA
AAATTAAGAAAGATTGAAAGATTGGAAGACAGACAGATAGACAGAAGGAAAGAAGGAAAGAAGGAAGGAAG
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148230080..148230230 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


SPLK-Sequence tag 3SD111G08
Sequence
AGGCTGCACCCAAGCTTCCTGTTACTGGCTCCCGAAGAAACCAGTCAAATCTCCCCTTGTTGAGAACATTTTGACAGCAT
AAAATTGCTGCCGGAATGTGACTTTAACGAAAAGT
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148230316..148230430 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es