Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D111G02
Clone ID D111G02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD111G02
Sequence
AAAAAAAAAACCCCCGTGGGGGGGCCTTTAAGGGAAAATTTGTTTCCCGGGGGCCCAAAAAAAAAACCCTTCCCCCCCCT
CCCCCAGGGGGGGGTTTCCCCCCCCCGGGGGTTTTTTAAAATTAAAAAAGGGGGGGGCCCCCCCCTTTTTTTTTTTACCC
CCCCAAAAAAAATTTGGGGGGGGGGGTTTTTTTTTTTTTTTTTTTTNGCCATTCAAAACAGGGTTTCTCTGGGTAGTCCC
GGCTGTCCTAAAACTCAGTTTTTAGACCCGGCCGGGTTCCTACTTAGTAAAAATCTCTTGGTTTTGAGGGCTTGGATTAA
AAGGTGGGCACCCCCCATGCCTGGCAGGCATTTTTTTTTTTTCCCACACACTGACATAATTTCTATGTGTGGCCCTAGCT
GGAGTAAAACTGATTGTATAGACCAGGCTAGTCTCTCCCTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD111G02
Sequence
CAGCTTATCCCTTACCTACTCCCGATCCACTTTTTGTGGGAACTATGTCAAATATGTTTGTTCTGTTCATTTCTTACTGT
TTTGTCTTCTTTAGGCCAAGTCATGACTACAGTAGTGGTACATGTGGACTCCAAAGCTGAGCTCACTACCCTGCTGGAGC
AGTGGGAAAAGGACCATGGCAGTGGCCAGGATATGGTACCAATCCTTTACCAGGTAAGAATCATTTGTTGTTTTTTTTTC
ATAGAAAACTGGCCTGTTTTTTCATATACACAAAACTATTTTAAAAAAAATAGGTGTGTT
Sequence Type genomic DNA
Unitrap ID UNI30119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106731297..106731596 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es