Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D111D09
Clone ID D111D09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD111D09
Sequence
TTTTTGATCAAGTCCCAAATCTGCCAGCCTGTCCTCTCCT
Sequence Type genomic DNA
Unitrap ID UNI29769

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165708871..165708910 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


SPLK-Sequence tag 3SD111D09
Sequence
CTCCTAACTGGGGAAAAGTGAGACNNNTTGCTTGAACGTGTGTTGGGTAAGTAAACCTGCCTCCTCTGCGAACGTGGATC
AAGAGTTTGGTGAACCTCTGGGGTCTGTGGTAATGGGGGTGGGGAGAGGGTGGCTTCCAGAGAGTGTCTTTGAGTTTAGG
TGATGGCTGGAATCCACTGTTGTTCCTGCTAATCTGCAGTTAGGGCTGCAGCTCTCACTTCCTGCTTACTCTCCGCTGGG
GGCAGGAATTACTGGGTTCCTTGTGACTCGCAGCTAGACCTTGGATTGTGCTTGGCTCTTCTGAACTCTGGGTAGGGGAT
CTGCTTGTGNNNNGCGAGCACAGCTGTTTTGTCCTTCCAGGGTTCCAGAGGCCCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es