Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D111C01
Clone ID D111C01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD111C01
Sequence
ATTCTCGTCAGTGTCACAAGAGAGGTGATTACTTATANCACTCCATTTAAAACAAGCACCTTTGAATTTCAAGGTTGTCA
TTAGTCAACATAGTTAAGGGAGCCCAACTTAGTGGAAGGGGATTTTTGAAAAAGAAACTGATAATATTCAAATAGTATAC
GGCAGGAATTCGAGGTTT
Sequence Type genomic DNA
Unitrap ID UNI30122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65758182..65758359 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032384 (Csnk1g1) NM_173185 casein kinase 1, gamma 1 Gene [Source:MGI (curated);Acc:Csnk1g1-001]

 
Come back to gene ENSMUSG00000032384


For any suggestions or comments, please send an email to unitrap@crg.es