Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D110G12
Clone ID D110G12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD110G12
Sequence
TCATCCTGGCCTCTGCAATCCCAGGACAATGCAAGTTAGCAGAGAATGTTCCTTCCCGGAGTATCAGCAGCTCTTGACCC
CATCTTTGGCCAAGTCTCTTGACATTGTCCCCAAACTTCCTAGGAAAGACCTGGCTCTGCTTACATCTTTTCCCAAAAGT
TT
Sequence Type genomic DNA
Unitrap ID UNI29495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4972966..4973127 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074405 (6430526N21Rik) NM_001033383 RIKEN cDNA 6430526N21 gene Gene [Source:MGI Symbol;Acc:MGI:2442656]


SPLK-Sequence tag 3SD110G12
Sequence
GTTTTATTCTTCGCTGAATGAACACCGCCATTCTATACCCAGGCCTTGCAGTTTCAGAGAGGAGAGAGATGCAACGAGCC
CTCATTTTACAGGGTGCTTACAGCCTAGTTGAGAGGCAGATCAGAAACAGTGCTGCTCTGTGGGTTTTCTGAGAGTCTGG
TGAGCTACGATGTGAATGCTTAAACACAAGATTTAATCTTGCCATTCACAG
Sequence Type genomic DNA
Unitrap ID UNI29495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4973124..4973334 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074405 (6430526N21Rik) NM_001033383 RIKEN cDNA 6430526N21 gene Gene [Source:MGI Symbol;Acc:MGI:2442656]

 
Come back to gene ENSMUSG00000074405


For any suggestions or comments, please send an email to unitrap@crg.es