Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D110G09
Clone ID D110G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD110G09
Sequence
AGGAAGGATGAAAGGGTGGGTTGGGGGAACCTTCTACCCTCCCTAGCTCACGCTGTGGAAATAAGCGTGGAACCATGTCT
TAGGTGCCTGGCCCAAAAATGTAATTTATCATTCTGTTTACCTGAGTTCAACTATAAATGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD110G09
Sequence
GTTCACTAAAGGGATACATGGCAATGAAATAACACACATTAGCCTCTTAGAGTAGAACCTAGAACACAGCGAACACCAGA
ACAATTAGTTCTTAGTTGTTTTACTTAAACGAAGGGAGAAGCACCATTTTCTGAGATTCTTCCTGTATACTTTGGTGAAA
ACAGAGCATGCTCCAGGAGGCGTGGCCACTCAGCAATCCCCTCCCCTGCCCTATGCTGTGTCTCTGGCTATTGGTTCTTG
TGGCAGTGTGTTCTCCTTATGTGTGGGACTGGGGGGTGGGGGGAGTCCCAGGGTGGTCTGCATTTGTCAAGGCCAGAATG
AAAGGGAAAGCAGAGCTGCAGATGGACCTGTGCTGTCCATAGCCCAGAGAGCGTCTGTGATGAAGCATGGTTCGTTTACA
ACTCCCCTCCCCCCTTTTTAAAGA
Sequence Type genomic DNA
Unitrap ID UNI20391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66861502..66861925 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023460 (Rab12) NP_077768 RAB12, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab12-001]

 
Come back to gene ENSMUSG00000023460


For any suggestions or comments, please send an email to unitrap@crg.es