Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D110F07
Clone ID D110F07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD110F07
Sequence
ATTTCAAGTACTAATGACCATGTTGCAAGGGCTTTTTGTTCCTTTAATCTAATCTGTAGTAGCAACTTATAACAGAATGC
TGTCTGTATCTCAGAAGCTCACTGAGGA
Sequence Type genomic DNA
Unitrap ID UNI12064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28273817..28273924 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008384 (Sertad1) NM_018820 SERTA domain containing 1 Gene [Source:MGI (curated);Acc:Sertad1-001]


SPLK-Sequence tag 3SD110F07
Sequence
AATAAGAATTTGCTTAGAAAACCTAGACCTGGAGGTTAATCGACTGGTCAGG
Sequence Type genomic DNA
Unitrap ID UNI12064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28274138..28274189 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008384 (Sertad1) NM_018820 SERTA domain containing 1 Gene [Source:MGI (curated);Acc:Sertad1-001]

 
Come back to gene ENSMUSG00000008384


For any suggestions or comments, please send an email to unitrap@crg.es