Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D110D01
Clone ID D110D01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD110D01
Sequence
GATCCATTTTGTCTACAATGAAAGAAAAACCCGAAAAGTTCAAAGACACTCGCAAGTTATGGGAAGCAAGAAGAAAGGGT
GTTTGGTGTCCTGCCCTGCGAGGAGCTGAAGTGCACTGTCAATGCCTTGTCGATACTTGGGTGGTACTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD110D01
Sequence
CATTAGACCAGGGTTTCTTTTCCCGCAAAGCTAATTTTCCTACAAACTAGTGAGAATGTTCACAAAGACAAACATCACAT
GACTTCCTTAGTGTGGAAGCTAGAGGGGAAAAGGAGGGCACAAAACTAAAGTAGGAGAGCTGGGGGTGGGGTGGAGTAAG
AAAGAGTAGAGGGGTGAGTGAGATCAAGTCCTTTAT
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102933739..102933934 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es