Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D110A12
Clone ID D110A12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD110A12
Sequence
GATCTCTTTGGGTATACAAGGGCCTGATAAAGTAACAGAATAATTCTAATTTTAGAGAAGGCAAGTGGTGTGGAAAACCA
CTGGAGGAAGCTTTGCTTCTGTTTGTATTTCTGGG
Sequence Type genomic DNA
Unitrap ID UNI30125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94758740..94758854 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005774 (Rfx5) NM_017395 regulatory factor X, 5 (influences HLA class II expression) Gene [Source:MGI (curated);Acc:Rfx5-004]


SPLK-Sequence tag 3SD110A12
Sequence
GGGTAGAGACAGGAGGACTGCCTTGGGGTCTCTAGGAGAAAGGAAGCTTGGTAGTAGTTAAATCCTCAGCGATCTCCTCT
CTCAGCTGTAGCCCTCATGCTGGGATGGCAGAAGATAAACCTGATGCTAAGAGCCCCAAGACTGGGGCAAGGCCCCAAGG
TGGTGCTGACGCTGGAGAACCTACCACCCTCCTCCAAAGGCTCCGAGGTACCATTTCGTAAGTAATTGTCTCTGTCTCCA
AACCCTGTTCCAGACCCAGCTGTAG
Sequence Type genomic DNA
Unitrap ID UNI30125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94758852..94759116 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005774 (Rfx5) NM_017395 regulatory factor X, 5 (influences HLA class II expression) Gene [Source:MGI (curated);Acc:Rfx5-004]

 
Come back to gene ENSMUSG00000005774


For any suggestions or comments, please send an email to unitrap@crg.es