Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D110A02
Clone ID D110A02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD110A02
Sequence
TCACATAGTCTAAGAGACTGCATACTCAATCTGACTGAACCAAAATCTCCATGCTTCTGTTTCCTTTCTGCAGAGCTGGG
AGCGGGACCCTGGTTTGAGGCATGCTAACCGTACACATAGGTACGGTTCCTGTGCACTGTCTCTGAGCTATACCCTCAGC
CTTCAATGCTGCATTATCATTACAGTCCCCAGGGCCAGGAGCATGGCTCTATGAGTCTCTGCTCTTCTTACTCACGTCTG
TCTTGCCCCTCACCCTTAACTCTGCTCCTGCAGCCTTTCCTGGGGCTGTTGGTGCCCAGGGTCGTGAACTCTGGGCCTGA
TGTGGTGGAGCGTCTGGCCTGTCTTGGTGCCCAGTGTCTGGCATTCAGTTAGAGAATTTGTTGAAGACAGGCAGCCTTAG
TGGGCAGAAGGCTTGTCCAGCTGGGGAGATTGGAAGGGGGCTCTGGTTGAGTTGGGAGGTGTAGCAGCTTGAGGCTTGAA
GCCAGAGCACTTAAGGAGACAGACAGTCAAAGCCTCTCAGGTAATTAGAGGTCCCGT
Sequence Type genomic DNA
Unitrap ID UNI15218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27197212..27197748 537
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]


SPLK-Sequence tag 3SD110A02
Sequence
GGAAGGGTCTGGGGAGTGAATCTAACAGGCCCACACCTGTTCTTGGCAGGGAAGCGTGGACGCGGCTGGCCTCGCCCCTC
ACCCNNGTGGAGGCATAAGAGGCCAGAGCTGGCGCTGCAGACTGGGGAGGAACATGGGGGAAGGCGGCTGTGGCTTGTGG
CCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es