Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D109G11
Clone ID D109G11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD109G11
Sequence
GATCTTTGGAAGTTTAAGGTCAAGGACTCTGTCAGACTTTTTGCCCCTGTTTGAAATGCTTGGTTGTGTGATTGAAGGCT
GGCTCTATGCGGTTGGACATTTCTTGTAG
Sequence Type genomic DNA
Unitrap ID UNI26978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97526000..97526108 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]


SPLK-Sequence tag 3SD109G11
Sequence
GTAGTCCTGTTCCATTGAGTGATCCCGGGTCTGGGGAGCAGCCCCACCTACTGGGCTGGCTTTAGTAGGCTGGGTCTCTT
CCCTGCCTGCCCCCAGTTACTCTGTGGGGGGGGGAACCATTGGCTGATGGCTTTGCTCAGTGAGTCTCCTTCCCCCACCC
TTAGCTTGCTATGGCATCGTCCAGGTGCCAACAGGACCCTGGTTCTGCAGGAAATGTGAATCTCAGGAGCGTGCAGCCAG
GGTGGTGAGTCCAGCCCCTCTCCCTTTCCTCTCCCCTACACCTGAGCATCTCCTGCAGGTAAATAGGGTACCCTGAGGCT
GGGGCAGGACTAAGCTCTGTCACTCAGGATTTCCTGTTTGCTGCTGCCTATCACCAGCCCCATCTCTCCCTCAGCTCTGC
ACTCAGCTCTGCCCCGCCTCACCTCCGGCTTGGGGGCTTTGATTTTTTTGGGGGGGGTGTCTATGTGCTGCTTTGTAACT
TTTTACTATGAAAGGTTTTCAAGGCTATGGAAGTTGAGGGGCCGCTGTAGTGACCAGCAGGTTCTCCTTATTCAGCCTTC
AGCAGTTAGGAGCCTCTTTGCTCTACAGCCTCAGCCCCCACCCAGATC
Sequence Type genomic DNA
Unitrap ID UNI26978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97526105..97526712 606
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es