Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D109G09
Clone ID D109G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD109G09
Sequence
ATGTTAAATGTTACATGAAATCTGAAGGAGGCATGTGTCTGTTTTACAATTTTAACGGTTTTCATGCACTGAAAATAAGT
TGTTTTTTGTATTGCTTATCCTAAAATATGGTGGAAGTACTATTTTACTTTCAAGGACAGGAACAGTGGCTTGCAGAGTG
TGTAGTTTTCAGCCAGGAGTCTAATGGATTCAGGAGGACTCATTTATGGCAGATGCCTTCTAAATTTTCATGTTAAGTTG
CCATTTTGTGACATCGAGGACACGTTTGTTATTTCCAATGGATTGGTGACTCCCTGGAGCCTCTCTGCGTCTCAGTTTTC
TGTGTGTGGCTACATCTGGTGTGATACATTATCCCCTTCAGTCTGATGAATAATACCAGCCCTTCTCACCCTGAGACAAT
GAAGCAGACAGATTGCAGCTCAAGGGGCATTCCCCAACCCCCTTCCACAGCTGATCATGACAGTTGTGTCCCCCTCCCAG
CGAGGCTGGCCCCAGGAACATCCCCTCTACCCCTTTCTCTGCCAATGGACAGCTTTCCTTTGTCGCACTGCTTGGCTGTG
CCCATTGTTTGGGCCTGCTGCTTGGTACACGGGGCAGCTTTCCTCAATAGCACCTTGGATGGTGGTGTTTTTTTCTTTGT
CTGAAGTGTAAGCTTCATTTAAATTACGACNNNCAGTTTCATCTAAACAACGGCTTTTATTAACATC
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21863949..21864655 699
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es