Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D109G03
Clone ID D109G03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD109G03
Sequence
GATCCAGGCCTGGGTTCGAGGGCAGCGACCAGGAAGCCCTGAGGAGGCCGCAGTTCTTGTTGAGGGGCTGC
Sequence Type genomic DNA
Unitrap ID UNI30128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13564628..13564698 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033961 (Zfp446) NM_175558 zinc finger protein 446 Gene [Source:MGI (curated);Acc:Zfp446-001]


SPLK-Sequence tag 3SD109G03
Sequence
GCTGCAGCATGATCCTGGGCAGCTGCTGGGCTGGGTGAGTGAAATGACATTAGCTTCTTAGAAGGACAGATCGAAGGGAG
AGCCCCTGTGACATGATTCTCTTCAGATCACAGCCCACATCCTGAAGCCAAAGATGCTTCCTCTAGTCCAGAAGGAGTCC
TCAGGGAGTCACCACATCTCAGCAGCAACGGAGTCCTCCAAGGCAGGCCTTGTGGAGGCACCGCTGAAGGCCGGGATAGA
TCGATCTACCCAGATCAGTTGCAGTGTGAAGGAGGAAGTCAGTGCTGATGGGCAGGAGATGGGTGAGGGAATGCAACATG
TGAACTTCAAATCCCTGGGGTGGGGATAGGGGTAGGGGTGAGGTCAGAGCACGGTGTCAGGGCTGCAGCTCCTAAACTGA
GTCTGACAATCCCAGCTGAGATAGGGACTCTGGAGAGACCATAAAGCTGG
Sequence Type genomic DNA
Unitrap ID UNI30128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13564694..13565143 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033961 (Zfp446) NM_175558 zinc finger protein 446 Gene [Source:MGI (curated);Acc:Zfp446-001]

 
Come back to gene ENSMUSG00000033961


For any suggestions or comments, please send an email to unitrap@crg.es