Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D109F05
Clone ID D109F05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD109F05
Sequence
CTCTTTATAATGGAAATTTTCAAATCCGGTAATGTGTTGAAGCCTCGGGCAATCCTGTTCTTGCCCCACCCTACCCATAT
CCTGTCTGCTGCAGGCTCTAAGCCGAGGGGAGAGGGAAGTGTCCTGGGTAGGGTGAGGCAGATAAATCCCTTCAGCCCTA
GAGGGTGGATTGCTGCAGCCCTAGTTCCTATAATAGTAGTACATGCTGGGATTTAGTACTGAGGTGATGGGAATTACTTA
TTCAAAGAGACTGGGTTTCCAGTCAGTTCCTCAGTGTGCCCATATATTGAATGAATACTAATTTTTCTTGGTGAGTGGCC
AGAGAAAGATACATTACTATTTTGAAGGTAAATGTGTTTTAAATCTATGTGCAAATATTTTAAAATTGTAGCCAAGACAG
TCCGCAGATACTGTTCAGTAAATTGAAGTCTAAACAACATCCAAGAGGGTAGAGAGGAATTGGAAGTGAGGCCTGAGGGA
AAGGGTGGCTTGTTTGTGTCACCCCAGAGCCAGATGTCCTAGGAATAGTCTGGGAGGAGATGGATGGATG
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22751123..22751672 550
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]


SPLK-Sequence tag 3SD109F05
Sequence
GATGGACTCTTACCATAGGGCAGAGGCGACTGGATGCATGGGAAGAGTGATACTTGGTTCTTATTGGTGGGGTGCTAGGG
GGGCATCCATCTTTTAGGGCTCTTGAGGTGTGGCATGTAGTCTGCCTCTCTCTGGGCTCAGAGCCAGTCTCAGCTTTCCT
GGAGCCATTCTGTTTGGCAAACAGACCTGGGAGGAGAGGTACATTGAGGGGACTAG
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22750911..22751126 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es