Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D109B08
Clone ID D109B08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD109B08
Sequence
GATCTCTAGGGCAGTATCTTGGGTTTGAGCAGAAGTGGCTTTACTCGGGATAGCTCTGCACTCTGCTTTCCTTAGGAGGC
ACCCGCCTGAATTCAGGAAGACAGTGTGATTCACAAATATGTCAGTGTGGTCCCTTGAAGCCATGGCTGTCATATGCGTT
TCTGCCATGTGTTGAGGACCTGGGCTTTCAGGATGTTCTTGGTAGCTGGAATTTTA
Sequence Type genomic DNA
Unitrap ID UNI30130

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53646732..53646947 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]


SPLK-Sequence tag 3SD109B08
Sequence
GGAGATTGTNNNGCATATCTTGCCACTAGGTGACCCAGGTGTATTCTGCCAATTAAGGTCAGCGACCATTGTTTCAGCCA
TTTCTCCAGAACATTCTGTTCCAGGTAGCAAGTGAAGTCTTTTCTACCTTATTTTATTCTACTGTGGTT
Sequence Type genomic DNA
Unitrap ID UNI30130

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53647155..53647251 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]

 
Come back to gene ENSMUSG00000042195


For any suggestions or comments, please send an email to unitrap@crg.es