Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D108G03
Clone ID D108G03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD108G03
Sequence
ATTTTACTATTTTCTCTGCACACTGTTCACAATTAGCTATTATTATTTGAGCACTGCAATGAATTCTCCTTAATAAAACA
TCTTCAAAGCATGGAATAGTTAGGTCTGACATGGAATCGAGCCTGGCTCCAAGAAAGTACCTCCCCTTGCTTAGGGCTTC
CTTGTTGAGGGTGCTGTGATCTCACTGTGGAGGTTTGCTGAGGACAGCTCAGTTTCTGGTGTTACAGGAGGCTCAGGAGG
AAACTGAACTGGTGGTGCTAGGTCAGGTGAAGTGACTGATGGAGGAGTAGGTTACAGAGCCAGAGATAA
Sequence Type genomic DNA
Unitrap ID UNI22331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5560868..5561176 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]

 
Come back to gene ENSMUSG00000039145


For any suggestions or comments, please send an email to unitrap@crg.es