Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D108B09
Clone ID D108B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD108B09
Sequence
ACTGTTTTGTTTTCCTAAGAGACTCTAATTCCATAGTCATCACAACATGGAATTAGTGACAAATAACTACAGCAAAAACC
AGTCTGTGTTCACCAAGCTGCACTTCA
Sequence Type genomic DNA
Unitrap ID UNI30045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71302156..71302262 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041921 (Metapl1) NM_025633 methionine aminopeptidase-like 1 Gene [Source:MGI (curated);Acc:Metapl1-001]

 
Come back to gene ENSMUSG00000041921


For any suggestions or comments, please send an email to unitrap@crg.es