Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D107D03
Clone ID D107D03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD107D03
Sequence
TGCCACCTGTTATCTTGGCCTTTGTTGTCTGTACTTTTGGAATTAG
Sequence Type genomic DNA
Unitrap ID UNI10404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62961246..62961291 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]

 
Come back to gene ENSMUSG00000021932


For any suggestions or comments, please send an email to unitrap@crg.es