Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D107C06
Clone ID D107C06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD107C06
Sequence
CCTGTGCTGTCCTCTTTGAAGAAATAATTATCNNNNGGGCTTTCTCAAAGGTTACGCGGCATTATAGAGTCCTTGCTAAC
ATCTTCTACNNAGTGCTGCCTGCTGCTTCTGGAGTCCTTATGCCTTGGTCTTATCCTCATACTCCGCTTTTCGGTCTTTA
TCTATTTAGGGGNNGCGTCTTCATAGAAGATTTCTCAGCAGAAGCTTCTGTGNNNATACCGGGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD107C06
Sequence
TATATTTGACAGCTTTACTCTTTTAGTCGAAAGTATGGTTACTGGGACCACAACCCTCCTGCATCTGCCTTCCAGATACT
AGCACCGCAGTACTTGGCTTTAGTTTCAT
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30906062..30906170 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es