Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D052G01
Clone ID D052G01
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D052G01
Sequence
CATNNNCAAGAGGCACGAGCTGGTGAAGGGGCCGAAGAAGGTCGAGAAG
Sequence Type mRNA
Unitrap ID UNI10473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 79954181..79954223 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 172266197..172266239 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027502 (2410001C21Rik) NM_025542 RIKEN cDNA 2410001C21 gene Gene [Source:MGI Symbol;Acc:MGI:1913654]


SPLK-Sequence tag 5SD052G01
Sequence
TCAAGACAATTGGTGTGGACCAAGGGCTNNNCGCGGCGACCCCGCCCCTTTCGCGGCGCGCTGGTTGTGTGCGTCATCAA
GGAGCGCCGGAAGTAGGTAGGGTTTCGCCAGAGACCCCGGAAGCGACGGCTTCTCGTCTTTGCTAAGGCTTCTGGTTTTT
GCTACGGTTTCTGATTTCGGCTTTGGGATGGGTTGCGACGGAGGCACCATCCCCAAGAGGCACGAGCTGGTGAAGGGGCC
GAAGAAGGTCGAGAAGGTCAGTGGGGACTGCGGGCTGCGGGGCTCGGGATGAACGGTGGTCACAGCGCTTGTGGAGGGTT
TACTGTTTGCAGGCACTGAACAGTACGGTTAGACTGGGATTCTCCCCACAGACGCTGTGTTGATTTGTAAACATTAACGT
TGAACGGGACGGAGACTGGAGAGCTAGTTAGTGGCCTAGCCAGGACTGGGACGTATCTGTAGCTAGCGACGATTACGGTG
ATAGATGCTATTTATGGA
Sequence Type genomic DNA
Unitrap ID UNI10473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 172265985..172266480 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027502 (2410001C21Rik) NM_025542 RIKEN cDNA 2410001C21 gene Gene [Source:MGI Symbol;Acc:MGI:1913654]

 
Come back to gene ENSMUSG00000027502


For any suggestions or comments, please send an email to unitrap@crg.es