Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D106B04
Clone ID D106B04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD106B04
Sequence
AACTATCAGAACTAAGTGTCAGCGAACACGTGAATTATATAAGAGATACAGTTGATTAAACTGGAGAAAGGAGAGCTCTC
TGCTCTCAAAACTTAGAAATTGGAAACTTAGTTGAACTGCACTGCAGGGCTACTACCAAGGCAGTGCCACCGGGATGTAG
TTAATCCCTAGTCCTTATGGTAGCCCCAACAGAAATCTAAAGCCTGTTTAATGGAAAAATGG
Sequence Type genomic DNA
Unitrap ID UNI21475

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13629822..13630043 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031922 (Cep57) NP_080941 centrosomal protein 57 Gene [Source:MGI Symbol;Acc:MGI:1915551]

 
Come back to gene ENSMUSG00000031922


For any suggestions or comments, please send an email to unitrap@crg.es